* * * * *
-**Based on materials by Katy Huff, Rachel Slaybaugh, and Anthony
-Scopatz**
+**Based on materials by Katy Huff, Rachel Slaybaugh, Anthony
+Scopatz, and John Blischak**
+
+**Presented by John Blischak**

# What is testing?
## Exercise: Writing tests for mean()
There are a few tests for the mean() function that we listed in this
-lesson. What are some tests that should fail? Add at least three test
-cases to this set. Edit the `test_mean.py` file which tests the mean()
+lesson. What are some tests that should fail? Add one more test
+case to this set. Edit the `test_mean.py` file which tests the mean()
function in `mean.py`.
*Hint:* Think about what form your input could take and what you should
What should be done if you pass a list of integers? What if you pass a
list of strings?
-**Example**:
+**To run the tests**:
nosetests -v test_mean.py
```
The tests that we must pass are contained in the file
-`test_calculate_gc.py`. We can run the tests using nosetests.
+`test_calculate_gc.py`. We can run the tests using `nosetests`.
nosetests -v test_calculate_gc.py
further modifications (regression tests). What would be the next test
you would write for our function?
+## Exercise: Test function that transcribes DNA to RNA
+
+In the lesson yesterday on functions, `05-python-functions`, one exercise
+asked you to write a function to transcribe DNA to RNA. An example of
+that function is implemented in this directory in a file named
+`transcribe.py`. In that lesson, there were two tests to check your
+work:
+
+```python
+transcribe('ATGC') == 'UACG'
+transcribe('ATGCAGTCAGTGCAGTCAGT') == 'UACGUCAGUCACGUCAGUCA'
+```
+
+Convert these to a proper test and place it the file `test_transcribe.py`.
+Next, add a few tests of your own and run the test suite with nosetests.
\ No newline at end of file
--- /dev/null
+def transcribe(seq):
+ """Transcribes a DNA sequence to RNA.
+ Input: string of A's, T's, G's, and C's
+ Output: string of RNA basd on input DNA.
+ Converts using the following rules:
+ A->U, T->A, G->C, C->G
+ """
+ rna = ''
+ for letter in seq:
+ if letter == 'A':
+ rna = rna + 'U'
+ elif letter == 'T':
+ rna = rna + 'A'
+ elif letter == 'G':
+ rna = rna + 'C'
+ else:
+ rna = rna + 'G'
+ return rna
\ No newline at end of file