From 2347a03a5f4264db47103056ddc34a4950f4bf2e Mon Sep 17 00:00:00 2001
From: John Blischak <jdblischak@gmail.com>
Date: Sun, 16 Jun 2013 22:20:22 -0500
Subject: [PATCH] Added another testing exercise using transcribe function.

---
 09-testing/Readme.md          | 29 +++++++++++++++++++++++------
 09-testing/test_transcribe.py |  4 ++++
 09-testing/transcribe.py      | 18 ++++++++++++++++++
 3 files changed, 45 insertions(+), 6 deletions(-)
 create mode 100644 09-testing/test_transcribe.py
 create mode 100644 09-testing/transcribe.py

diff --git a/09-testing/Readme.md b/09-testing/Readme.md
index d32a61b..bbfa64d 100644
--- a/09-testing/Readme.md
+++ b/09-testing/Readme.md
@@ -2,8 +2,10 @@
 
 * * * * *
 
-**Based on materials by Katy Huff, Rachel Slaybaugh, and Anthony
-Scopatz**
+**Based on materials by Katy Huff, Rachel Slaybaugh, Anthony
+Scopatz, and John Blischak**
+
+**Presented by John Blischak**
 
 ![image](https://github.com/thehackerwithin/UofCSCBC2012/raw/scopz/5-Testing/test_prod.jpg)
 # What is testing?
@@ -326,8 +328,8 @@ assert_array_almost_equal(a, b)
 ## Exercise: Writing tests for mean()
 
 There are a few tests for the mean() function that we listed in this
-lesson. What are some tests that should fail? Add at least three test
-cases to this set. Edit the `test_mean.py` file which tests the mean()
+lesson. What are some tests that should fail? Add one more test
+case to this set. Edit the `test_mean.py` file which tests the mean()
 function in `mean.py`.
 
 *Hint:* Think about what form your input could take and what you should
@@ -335,7 +337,7 @@ do to handle it. Also, think about the type of the elements in the list.
 What should be done if you pass a list of integers? What if you pass a
 list of strings?
 
-**Example**:
+**To run the tests**:
 
     nosetests -v test_mean.py
 
@@ -374,7 +376,7 @@ def calculate_gc(x):
 ```
 
 The tests that we must pass are contained in the file
-`test_calculate_gc.py`. We can run the tests using nosetests.
+`test_calculate_gc.py`. We can run the tests using `nosetests`.
 
     nosetests -v test_calculate_gc.py
 
@@ -433,3 +435,18 @@ of what the function does, but can also be easily ran again if we made
 further modifications (regression tests). What would be the next test 
 you would write for our function?
 
+## Exercise: Test function that transcribes DNA to RNA
+
+In the lesson yesterday on functions, `05-python-functions`, one exercise
+asked you to write a function to transcribe DNA to RNA. An example of
+that function is implemented in this directory in a file named
+`transcribe.py`. In that lesson, there were two tests to check your
+work:
+
+```python
+transcribe('ATGC') == 'UACG'
+transcribe('ATGCAGTCAGTGCAGTCAGT') == 'UACGUCAGUCACGUCAGUCA'
+```
+
+Convert these to a proper test and place it the file `test_transcribe.py`.
+Next, add a few tests of your own and run the test suite with nosetests.
\ No newline at end of file
diff --git a/09-testing/test_transcribe.py b/09-testing/test_transcribe.py
new file mode 100644
index 0000000..d9ac27f
--- /dev/null
+++ b/09-testing/test_transcribe.py
@@ -0,0 +1,4 @@
+from nose.tools import assert_equal, assert_almost_equal, assert_true, \
+    assert_false, assert_raises, assert_is_instance
+
+from transcribe import transcribe
diff --git a/09-testing/transcribe.py b/09-testing/transcribe.py
new file mode 100644
index 0000000..488b9b7
--- /dev/null
+++ b/09-testing/transcribe.py
@@ -0,0 +1,18 @@
+def transcribe(seq):
+    """Transcribes a DNA sequence to RNA.
+    Input: string of A's, T's, G's, and C's
+    Output: string of RNA basd on input DNA.
+    Converts using the following rules:
+    A->U, T->A, G->C, C->G
+    """
+    rna = ''
+    for letter in seq:
+        if letter == 'A':
+            rna = rna + 'U'
+        elif letter == 'T':
+            rna = rna + 'A'
+        elif letter == 'G':
+            rna = rna + 'C'
+        else:
+            rna = rna + 'G'
+    return rna
\ No newline at end of file
-- 
2.26.2